Mantophasmatodea (Heelwalkers): DNA sequences

COI and 16SrDNA sequence alignments used for the cladistic analysis in Klass et al. (2003)

Reduv591     CCCGAAGTTTACATTCTAATTCTCCCAGGATTTGGGATTATTTCTCATATTATTGCAATAGAGACAGGAAAACAAGAACCGTTTGGCTCATTAGGAATAATTTATGCAATATTAACAATTGGTATTTTAGGATTTATTGTATGAGCACATCATATATTTACTGTAGGAATAGACGTAGATACTCGAGCATACTTTACATCAGCAACTATAGTTATTGCTGTTCCCACAGGAATTAAAGTATTTAGATGAATTGCAACTCTACACGGATCAAGATTTATTATATCCCCAAGCCTTATATGAGCTCTAGGATTTGTATTTCTCTTTACTATTGGCGGCCTAACGGGAGTTATCTTAGCCAATTCAAGTATTGATATTATTTTACATGACACATATTATGTAGTAGCCCATTTCCACTATGTCCTATCCATAGGAGCAGTATTTGCAATTATAGGAGGAATCATTCAATGATACCCCTTATTCACTGGACTAACATTAAAACCTAACTGATTAAAAATACAATTTATAATTATATTTATTGGAGTAAATATAACATTTTTTCCACAACACTTTCTAGGACTAAGAGGTATACCACGACGATATTCTGATTATCCAGACAGATATACATCATGAAATATTATTTCCTCCATAGGAAGAACCATTTCACTTATAGGAACCATTTTCTTCCTAGCAATTTTATGAGAAAGAATAACATCCCAACGACAAATTCTATTCGCAATAAATTTACCATCCAATATTGAATGATTACAAAAATATCCCCCAGCTGAACACTCTTATTCAGAACTTCCTAT????????????ATCGAGGTCGCAAACTCCCTCATCAATAAGAACTTTCTGAAGAAATTACGCTGTTATCCCTAAGGTAACTTAATCTTATAATCCACAA-AGGGGATCAAAATACACATAAATTAATGAATCACAAAAAATAGAAGTTAT-TTTAATTCTACA-ATCACCCCAATAAAATAT-ATATTCACATCAATAAATAAAATTCCCTAAAATTATC-AACAAAAAAACATATAAAGATCTATAGGGTCTTCTCGTCCCACAATAAAATTTTAGCTTTTTAACCAAAAAATTAAGTTCATAAAC-TAAATTAAAGAAAGCATATATCTCGTCTAACCTTTCATTCCAGCCTCCAATCAAGAGACAATTGATTACGCTACCTTAGCACAGTTAAAATACCGCGGCCATTCAT--TAACTATCATTGGGCAGGTCAGACCTTATATTAAAATCAA-AAGGACATGTTTTTGTTAAACAGGCG   [1283]

Locust590    CCAGAAGTTTATATTTTAATTTTACCAGGATTTGGTATTATTTCACATATCGTTTGTCAAGAAAGAGGAAAAATTGAATCATTTGGAACAATTGGTATAATTTATGCAATATTATCAATTGGATTAATAGGATTTATTGTATGAGCTCATCACATATTTACAGTAGGAATAGACGTAGATACACGAGCTTATTTCACCTCAGCAACAATAATTATTGCTGTACCAACAGGAATTAAGGTATTCAGATGAATAGCAACATTATACGGAACTAAATTCAAATTCAATCCACCATTATTATGAGCATTAGGATTTATTTTCCTATTTACAATAGGAGGTTTAACTGGTCTTGTACTTGCAAATTCATCTCTAGATATTGTTTTACATGACACATATTATGTAGTAGCACATTTCCACTATGTATTATCTATAGGAGCAGTATTTGCAATTATAGGAGGAATTATTCAATGATACCCTTTATTTACAGGATTAACTATAAATAGTAAATGACTAAAAATTCAATTTACTATTATATTTATTGGAGTAAACTTAACATTCTTTCCTCAACACTTTCTAGGATTAGCAGGAATACCACGACGATATTCTGATTATCCTGACGCTTATACATCATGAAATGTTATCTCCAGAATTGGATCAACAATTTCAATCACAGGAATTATTATATTCATTTTAATTATATGAGAAAGAATAATTAAGCAACGAAATGTATTATTTAGAACAAATATAAGAAGATCAACAGAATGATTACAAAATAATCCACCAGCAGAACACAGATACTCAGAACTACCACTATTTAATCCAACATCGAGGTCGCAATCCATTTTACCGATAAGAACTCTAAAAAATGATTACGCTGTTATCCCTAAGGTAACTTAATCTTATAATCACAAATTATGGATCAA-ATAAACATAAATTAATG-ATT-TTATAATGAAGAGTTTA-ATTATTCTTCAT-GTCACCCCAACAAAACAA-TAAAAATTAACATTAAAAAATAAACTATATAATAAAAATTAATTTATAAATGTAAAGCTCTATAGGGTCTTCTCGTCCTCAAGAAATATTTAAGCCTTTTAACTTAAAAGTTAAATTCTAAAAA-TTATTAAGAGACAGTCAATTTCTCGTCAAACCATTCATTCCAGTCCCCAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCATAATACCGCGGCCCTTTAA---ATTAATCAGTGAGCAGGTAAGACTTCAAAATATTATCAA-GAAGACATGTTTTTGTTAAACAGGCG   [1282]

Phasm589     CCTGAAGTATATATTTTAATCCTACCAGGATTTGGTATAATTTCACATATTATTTCACATGAAAGAGGTAAAAAGGAAGTCTTTGGAAATATAGGAATAATTTTTGCTATAGGAGCAATCGGTCTATTAGGATTTGTTGTATGAGCACACCATATATTTACAGTAGGAATAGATGTTGATACTCGAGCATACTTTACATCAGCTACAATAATTATTGCCGTACCAACAGGAATTAAGGTATTCAGATGAATAGCAACTTTATATGGATCTAAATTAACAATAAGACCATCTTGTTTATGAAGTATAGGATTTGTATTTTTATTTACTCTTGGTGGTTTAACAGGAATTATTCTATCAAATTCATCAATTGATATTACCCTACATGATACTTATTATGTAGTAGCACATTTTCACTACGTATTATCTATAGGAGCAGTATTTGCAATTATAGCAGGTTTTATTCACTGATACCCTTTATTAACAGGATTAAATATAAATCCAACATGATTAAAAATTCAATTCATCACAATATTTATTGGAGTAAATTTAACATTCTTTCCACAACATTTCCTAGGATTAGCAGGTATACCACGACGATATTCAGATTACCCCGATATATTTACATCATGAAATATTATCTCAACTATAGGGGCCCTAATATCTACAATTAGAATAATAATATTTATTATAATTTTATGAGAAAGAATAATAAGAAGTCGACAAACAATATTCAGATCACATATAATAAGATCTATAGAATGAAATCAAAATCTACCACCATCTGAACACTCTTACAATGAATTACC?????????????????????????????????????????????AACTCTCAAGAAAAATTACGCTGTTATCCCTAAGGTATCTAAT-CTTATA-TCATTACAATAAGTTCTAAA-ATTCAATAATCATTGTAAA-AAAAAATAAAAAGTTTATAAGAATTCTCCATGTCACCCCAACAAAAAAA-TATAAATATTTATAAATAAATAAATCCTAACTATATAA--ATACCAATATAATAAAGATCTATAGGGTCTTCTCGTCCTATAATAAAATTTAAGCATTTTAACTAAAAATTTAAATTCAATTAA-TATAAATAAGACAGGTAATATTTCGTCAAACCATTCATACAAGTTTACAATTAATAAACTAATGATTATGCTACCTTTGCACAGTCAAAATACCGCGGCCATTTAA---AA-AATCATAGGGCAGGTAATATCTCA???????????????????????????????????????   [1281]

Mant588      CCAGAAGTTTATATTTTAATTTTACCGGGATTTGGTATAATTTCCCATGTTATTTCTCATGAAAGTGGGAAAAAAGAAGCTTTTGGAAATTATGGAATAATTTGAGCTATATCAGCCATTGGTTTCCTAGGATTTGTTGTTTGAGCTCATCATATATTTACAGTTGGGATAGATGTTGATACCCGAGCATACTTTACAGGAGCTACAATAATTATTGCTGTTCCAACTGGTATTAAAATTTTTAGATGATTAGCAACCATGTATGGTACAAAAATAATTTACAGTCCAGCTTCCCTATGAGCTTTAGGTTTTATTTTTTTGTTTACAGTAGGAGGTTTAACTGGTGTAATTTTAGCTAATTCAGCTATTGATATTATTTTACACGATACATATTATGTTGTTGCTCACTTTCATTATGTCTTATCAATAGGAGCAGTATTTGCTATTATAGCAGGATTTGTACATTGATACCCTCTTTTTACTGGATTATCTTTAAATTCAAATTGACTTAAAAGACAATTTTTTGTAATATTTATAGGAGTTAATTTAACATTCTTCCCTCAACACTTTTTAGGATTATCAGGAATACCACGACGATATTCTGATTATCCAGATGCATATACTTCATGAAATATTTTATCTTCTATAGGTTCAATAATTTCATTTATTGCTGTTATCATATTCATCTTTATTTTATGAGAAAGAATAACATCAAATCGATTAGCTTTATTTTCATCACAAATAAATAGATCAATTGAATGAGCAAATAATCTTCCCCCAGCTGAACATACATATAATGAATTAACTCT????AATCCAACATAGAGGTCACAATCACTTCTTTAAATATGAACTTTCAAAAAATATTATGCTGTTATCCCTAAGGTAATTTAATCTTTTAATCATTATTTATGGATCCT-TTATTTACTTAAAATATTTAT-TTT-AAAGAAAAGTTTT-ATTTATTTTCCA-ATCACCCCAATTAAATAATACAAATGATAATAATTAAAAATTTATACTAAACTTAATTAAAAATATGTTTATTAAACTCTATAGGGTCTTCTCGTCCCTTAATTTAATTTAAGTCTTTTTACTTAAAATCTAAGTTCAATTTA-TTAATATAAAATAGTTTATACTTCATCCAACCATTCATTCCAGCCTTCAATTAAAAGACTAATTATTATGCTACCTTTGCACAGTCAAAATACTGCGGCCCTTTAA---AATTTTCAGTGGGCAGGTTAGATCTCTTATAATTAACAATGAAACCATGTTTTTGTTAAACAGGCG   [1284]

Zeph628      CCAGAAGTATACATTTTAATTTTACCTGGATTCGGTATAATTTCGCATATTTTAAGCCAAGAAAGAGGTAAAAATGAAGCATTCGGTAATTTAGGTATAATCTTTGCTATATTAGCCATTGGTTTACTAGGTTTTGTAGTATGGGCTCATCACATATTTACAGTAGGAATAGACGTTGACACTCGAGCATATTTTACATCAGCTACAATAATTATTGCTGTTCCTACAGGAATCAAGATTTTTAGTTGACTAACAACTATATATGGTTCTCGTTTAACATATAGAGCAGCATGTTTATGATCTTTAGGATTCGTATTTTTATTTACAATTGGAGGATTAACAGGAGTAGTTCTAGCCAATTCATCAATTGATATTATTTTACATGACACATATTATGTAGTAGCTCATTTTCATTACGTTTTATCAATAGGTGCAGTATTTGCAATTATAGCAGGTTTTATTCAATGATATCCTCTATTTTCAGGTATAACAATAAACCCAAAATGATTAAAAATACAATTTATAATCATATTTGTAGGAGTAAATATAACTTTCTTCCCACAACATTTTTTAGGTTTATCAGGTATACCACGACGATACTCAGATTATCCAGATGCTTATACCACTTGAAATATTATTTCATCATTAGGATCAATTATTTCTCTAGTAAGAATTCTATTTTTCATCTTCATTTTATGAGAAAGTTTAATATCTAATCGCCAAGTAATCTCAAGTATAAATATAGTAAATTCTATTGAATGATTACAATCACTACCACCTGCTGAACATAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCCTTTTGTAGATATCAACTCTCAAAAAGGATAACGCTGTTATCCCTAAGGTAACTTATTCTTTTAATCCATAATAAAGGATCAA-TAATCCAATAATTATTGTAAT-AAATAAAGAAGAGTTAA-TTTTATCTTCCA-GTCACCCCAACTAAATAT-CAATAAATAAATAAAAATCAATCTAACCAATCAATATACAAAAAATTAAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAAAAACATTTAAGCCTTTTCACTTAAATGTTAAGTTCAAGTTT-TTAATATGAGACAGTTAACACCTTGTCCAACCATTCATACAAGTTTCCAATTAAAAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAATACAATTATCAGTGGGCAGGTCAGACTTTATAATATAATCA-TAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Pa.676       CCAGAAGTATATATTTTAATTTTACCTGGATTCGGTATAATTTCGCATATTTTAAGCCAAGAAAGAGGTAAAAACGAAGCATTCGGTAATTTAGGTATAATCTTTGCTATATTAGCCATTGGTTTACTAGGTTTTGTAGTATGGGCTCATCACATATTTACAGTAGGAATAGACGTTGACACTCGAGCATATTTTACATCAGCTACAATAATTATTGCTGTTCCTACAGGAATCAAGATTTTTAGTTGACTAACAACTATATACGGTTCTCGTTTAACATATAGAGCAGCATGTTTATGATCTTTAGGATTCGTATTTTTATTTACAATTGGAGGATTAACAGGAGTAGTTCTAGCCAATTCATCAATTGATATTATTTTACATGACACATATTATGTAGTAGCTCATTTTCATTACGTTTTATCAATAGGTGCAGTATTTGCAATTATAGCAGGTTTTATTCAATGATATCCTCTATTTTCAGGTATAACAATAAACCCAAAATGATTAAAAATACAATTTATAATCATATTTGTAGGAGTAAATATAACTTTCTTCCCACAACATTTTTTAGGTTTATCAGGTATACCACGACGATACTCAGATTATCCAGATGCCTATACCACTTGAAATATTATTTCATCATTAGGATCAATTATCTCTCTAGTAAGAATTCTATTTTTCATCTTCATTTTATGAGAAAGTTTAATATCTAATCGCCAAGTAATCTCAAGTATAAATATAGTAAATTCTATTGAATGATTACAATCACTACCACCTGCTGAACATAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCCTTTTGTAGATATCAACTCTCAAAAAGGATAACGCTGTTATCCCTAAGGTAACTTATTCTTTTAATCCATAATAAAGGATCAA-TAATCCAATAATTATTGTAAT-AAATAAAGAAGAGTTAA-TTTTATCTTCCA-GTCACCCCAACTAAATAT-CAATAAATAAATAAAAATCAATCTAACCAATCAATATACAAAAAATTAAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAAAAACATTTAAGCCTTTTCACTTAAATGTTAAGTTCAAGTTT-TTAATATGAGACAGTTAACACCTTGTCCAACCATTCATACAAGTTTCCAATTAAAAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAATACAATTATCAGTGGGCAGGTCAGACTTTATAATATAATCA-TAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Redel577     CCAGAAGTATACATTTTAATTTTACCAGGATTTGGTATGATTTCTCATATTTTAAGTCAAGAAAGTGGCAAAAATGAAGCATTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCACATCATATATTTACTGTAGGTATAGATGTAGATACCCGAGCTTATTTTACTTCAGCTACAATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTAGTTGACTTACCACTATATATGGTTCACGTATTTCATACAGTCCAGCTTGTTTATGATCTCTTGGTTTTGTTTTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTACTTGCCAATTCTTCAATTGATATTATTTTACATGACACCTATTATGTAGTAGCACATTTTCATTATGTTTTATCAATAGGAGCTGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCAGGACTAACAATAAACCCAAAATGGTTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTTTTTCCCCAACATTTTCTAGGATTATCAGGTATACCACGTCGATACTCTGATTACCCAGATGCCTATACTTCATGAAATATCGCTTCATCTCTAGGAAGAATTATCTCTTTAGTAAGAATTTTATTTTTCATTTACATTCTATGAGAAAGTATAATTTCAAACCGTCAAGTTATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAACTTTTACCTCCTGCCGAACATAGTTATGATGAACTTCCTTTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATTAATCAATAATTACTGTAAT-TTTTAAAGAAGAGTTAG-ATTAATCTTCCA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATAACTAATTAAAATATTAATATATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAACAAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATAATAAATATGAGACAGAAAATACCTTGTCCAACCGTTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAAATATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Rede578      CCAGAAGTATACATTTTAATTTTACCAGGATTTGGTATGATTTCTCATATTTTAAGTCAAGAAAGTGGCAAAAATGAAGCATTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCACATCATATATTTACTGTAGGTATAGATGTAGATACCCGAGCTTATTTTACTTCAGCTACAATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTAGTTGACTTACCACTATATATGGTTCACGTATTTCATACAGTCCAGCTTGTTTATGATCTCTTGGTTTTGTTTTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTACTTGCCAATTCTTCAATTGATATTATTTTACATGACACCTATTATGTAGTAGCACATTTTCATTATGTTTTATCAATAGGAGCTGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCAGGACTAACAATAAACCCAAAATGGTTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTTTTTCCCCAACATTTTCTAGGATTATCAGGTATACCACGTCGATACTCTGATTACCCGGATGCTTATACTTCATGAAATATCACTTCATCTCTAGGAAGAATTATCTCTTTAGTAAGAATTTTATTTTTCATTTACATTCTATGAGAAAGTATAATTTCAAGCCGTCAAGTTATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAACTTTTACCTCCTGCCGAACATAGTTATGATGAACTTCCTTTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATTAATCAATAATTACTGTAAT-TTTTAAAGAAGAGTTAG-ATTAATCTTCCA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATAACTAATTAAAATATTAATATATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAACAAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATAATAAATATGAGACAGAAAATACCTTGTCCAACCGTTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAAATATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Rede623      CCAGAAGTATACATTTTAATTTTACCAGGATTTGGTATGATTTCTCATATTTTAAGTCAAGAAAGTGGCAAAAATGAAGCATTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCACATCATATATTTACTGTAGGTATAGATGTAGATACCCGAGCTTATTTTACTTCAGCTACAATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTAGTTGACTTACCACTATATATGGTTCACGTATTTCATATAGTCCAGCTTGTTTATGATCTCTTGGTTTTGTTTTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTACTTGCCAATTCTTCAATTGATATTATTTTACATGACACCTATTATGTAGTAGCACATTTTCATTATGTTTTATCAATAGGAGCTGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCAGGACTAACAATAAACCCAAAATGGTTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTTTTTCCCCAACATTTTCTAGGATTATCAGGTATACCACGTCGATACTCTGATTACCCGGATGCCTATACTTCATGAAATATCGCTTCATCTCTAGGAAGAATTATCTCTTTAGTAAGAATTTTATTTTTCATTTACATTCTATGAGAAAGTATAATTTCAAACCGTCAAGTTATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAACTTTTACCTCCTGCCGAACATAGTTATGATGAACTTCCTTTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATTAATCAATAATTACTGTAAT-TTTTAAAGAAGAATTAG-ATTAATCTTCCA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATAACTAATTAAAATATTAATATATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAACAAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATAATAAATATGAGACAGAAAATACCTTGTCCAACCGTTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAAATATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Rede633      CCAGAAGTATACATTTTAATTTTACCAGGATTTGGTATGATTTCTCATATTTTAAGTCAAGAAAGTGGCAAAAATGAAGCATTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCACATCATATATTTACTGTAGGTATAGATGTAGATACCCGAGCTTATTTTACTTCAGCTACAATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTAGTTGACTTACCACTATATATGGTTCACGTATTTCATACAGTCCAGCTTGTTTATGATCTCTTGGTTTTGTTTTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTACTTGCCAATTCTTCAATTGATATTATTTTACATGACACCTATTATGTAGTAGCACATTTTCATTATGTTTTATCAATAGGAGCTGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCAGGACTAACAATAAACCCAAAATGGTTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTTTTTCCCCAACATTTTCTAGGATTATCAGGTATACCACGTCGATACTCTGATTACCCGGATGCTTATACTTCATGAAATATCACTTCATCTCTAGGAAGAATTATCTCTTTAGTAAGAATTTTATTTTTCATTTACATTCTATGAGAAAGTATAATTTCAAGCCGTCAAGTTATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAACTTTTACCTCCTGCCGAACATAGTTATGATGAACTTCCTTTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATTAATCAATAATTACTGTAAT-TTTTAAAGAAGAGTTAG-ATTAATCTTCCA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATAACTAATTAAAATATTAATATATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAACAAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATAATAAATATGAGACAGAAAATACCTTGTCCAACCGTTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAAATATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

RAI.651      CCAGAAGTATACATTTTAATTTTACCAGGATTTGGTATGATTTCTCATATTTTAAGTCAAGAAAGTGGCAAAAATGAAGCATTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCACATCATATATTTACTGTAGGTATAGATGTAGATACCCGAGCTTATTTTACTTCAGCTACAATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTAGTTGACTTACCACTATATATGGTTCACGTATTTCATACAGTCCAGCTTGTTTATGATCTCTTGGTTTTGTTTTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTACTTGCCAATTCTTCAATTGATATTATTTTACATGACACCTATTATGTAGTAGCACATTTTCATTATGTTTTATCAATAGGAGCTGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCAGGACTAACAATAAACCCAAAATGGTTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTTTTTCCCCAACATTTTCTAGGATTATCAGGTATACCACGTCGATACTCTGATTACCCGGATGCTTATACTTCATGAAATATCACTTCATCTCTAGGAAGAATTATCTCTTTAGTAAGAATTTTATTTTTCATTTACATTCTATGAGAAAGTATAATTTCAAGCCGTCAAGTTATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAACTTTTACCTCCTGCCGAACATAGTTATGATGAACTTCCTTTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATTAATCAATAATTACTGTAAT-TTTTAAAGAAGAGTTAG-ATTAATCTTCCA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATAACTAATTAAAATATTAATATATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAACAAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATAATAAATATGAGACAGAAAATACCTTGTCCAACCGTTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAAATATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

RAIII        CCAGAAGTATACATTTTAATTTTACCAGGATTTGGTATGATTTCTCATATTTTAAGTCAAGAAAGTGGCAAAAATGAAGCATTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCACATCATATATTTACTGTAGGTATAGATGTAGATACCCGAGCTTATTTTACTTCAGCTACAATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTAGTTGACTTACCACTATATATGGTTCACGTATTTCATACAGTCCAGCTTGTTTATGATCTCTTGGTTTTGTTTTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTACTTGCCAATTCTTCAATTGATATTATTTTACATGACACCTATTATGTAGTAGCACATTTTCATTATGTTTTATCAATAGGAGCTGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCAGGACTAACAATAAACCCAAAATGGTTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTTTTTCCCCAACATTTTCTAGGATTATCAGGCATACCACGTCGATACTCTGATTACCCAGATGCCTATACTTCATGAAATATCGCTTCATCTCTAGGAAGAATTATCTCTTTAGTAAGAATTTTATTTTTCATTTACATTCTATGAGAAAGTATAATTTCAAACCGTCAAGTTATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAACTTTTACCTCCTGCCGAACATAGTTATGATGAACTTCCTTTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATTAATCAATAATTACTGTAAT-TTTTAAAGAAGAGTTAG-ATTAATCTTCCA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATAACTAATTAAAATATTAATATATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAACAAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATAATAAATATGAGACAGAAAATACCTTGTCCAACCGTTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TTAATATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Mont579      CCAGAAGTTTATATTTTAATTCTACCTGGATTTGGAATAATTTCCCATATTTTAAGTCAAGAAAGTGGTAAAAATGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCACATCATATATTTACAGTAGGGATAGATGTAGATACTCGAGCTTATTTTACTTCTGCTACAATAATTATTGCTGTTCCTACAGGTATTAAAATCTTTAGTTGATTAACTACTATATATGGCTCACGTATTTCATATAGCCCTTCATGTTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGTGGCTTAACAGGAGTAGTTCTTGCTAACTCTTCAATTGACATTATTCTACATGATACTTATTATGTTGTAGCTCATTTCCATTATGTTTTATCTATAGGGGCTGTATTTGCAATTATGGCTGGTTTTATTCAATGGTACCCTTTATTTTCAGGTTTAACAATAAATCCTAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTCAATTTAACCTTTTTCCCTCAACACTTCTTAGGACTCTCTGGGATACCCCGTCGATATTCTGATTACCCTGATGCTTATACTTCATGAAATATTGCCTCATCTTTAGGTAGAATTATTTCTTTAGTAAGAATTCTATTTTTTATTTATATTTTATGAGAAAGTATAGCTATAAACCGCCAGGTAATTTTTACTTTAAATATTGAAAATTCAATTGAATGATTACAATTACTACCTCCAGCAGAACATAGCTATGATGAACTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATAAATCAATAATTACTGTTAC-TTAAAAGGAAGAGTTAA-ACTAATCTTCCA-GTCACCCCAACCAAATA--AAATAAAATAATATAATAAATAATATCTAATTAAAATAATAAATTATTACTATAAAGATCTATAGGGTCTTCTCGTCCTCCAATAACATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAAAA-TAAATACGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAGGAAACTAGTGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Mo.Av627     CCAGAAGTTTATATTTTAATTCTACCTGGATTTGGAATAATTTCCCATATTTTAAGTCAAGAAAGTGGTAAAAATGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCACATCATATATTTACAGTAGGAATAGATGTAGATACTCGAGCTTATTTTACTTCTGCTACAATAATTATTGCTGTTCCTACAGGTATTAAAATCTTTAGTTGATTAACTACTATATATGGCTCACGTATTTCATATAGCCCTTCATGTTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGTGGCTTAACAGGAGTAGTTCTTGCTAACTCTTCAATTGACATTATTCTACATGATACTTATTATGTTGTAGCTCATTTCCATTATGTTTTATCTATAGGGGCTGTATTTGCAATTATGGCTGGTTTTATTCAATGGTACCCTTTATTTTCAGGTTTAACAATAAATCCTAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTCAATTTAACCTTTTTCCCTCAACACTTCTTAGGACTCTCTGGGATACCCCGTCGATATTCTGATTACCCTGATGCTTATACTTCATGAAATATTGCCTCATCTTTAGGTAGAATTATTTCTTTAGTAAGAATTCTATTTTTTATTTATATTTTATGAGAAAGTATAGCTATAAACCGCCAGGTAATTTTTACTTTAAATATTGAAAATTCAATTGAATGATTACAATTACTACCTCCAGCAGAACATAGCTATGATGAACTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATAAATCAATAATTACTGTTAC-TTAAAAGGAAGAGTTAA-ACTAATCTTCCA-GTCACCCCAACCAAATA--AAATAAAATAATATAATAAATAATATCTAATTAAAATAATAAATTATTACTATAAAGATCTATAGGGTCTTCTCGTCCTCCAATAACATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAAAA-TAAATACGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAGGAAACTAGTGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Mo.675       CCAGAAGTTTATATTTTAATTCTACCTGGATTTGGAATAATTTCCCATATTTTAAGTCAAGAAAGTGGTAAAAATGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCACATCATATATTTACAGTAGGAATAGATGTAGATACTCGAGCTTATTTTACTTCTGCTACAATAATTATTGCTGTTCCTACAGGTATTAAAATCTTTAGTTGATTAACTACTATATATGGCTCACGTATTTCATATAGCCCTTCATGTTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGTGGCTTAACAGGAGTAGTTCTTGCTAACTCTTCAATTGACATTATTCTACATGATACTTATTATGTTGTAGCTCATTTCCATTATGTTTTATCTATAGGGGCTGTATTTGCAATTATGGCTGGTTTTATTCAATGGTACCCTTTATTTTCAGGTTTAACAATAAATCCTAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTCAATTTAACCTTTTTCCCTCAACACTTCTTAGGACTCTCTGGGATACCCCGTCGATATTCTGATTACCCTGATGCTTATACTTCATGAAATATTGCCTCATCTTTAGGTAGAATTATTTCTTTAGTAAGAATTCTATTTTTTATTTATATTTTATGAGAAAGTATAGCTATAAACCGCCAGGTAATTTTTACTTTAAATATTGAAAATTCAATTGAATGATTACAATTACTACCTCCAGCAGAACATAGCTATGATGAACTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATAAATCAATAATTACTGTCAC-TTAAAAGGAAGAGTTAA-ACTAATCTTCCA-GTCACCCCAACCAAATA--AAATAAAATAATATAATAAATAATATCTAATTAAAATAATAAATTATTACTATAAAGATCTATAGGGTCTTCTCGTCCTCCAATAACATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAAAA-TAAATACGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAGGAAACTAGTGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Bott631      CCAGAAGTTTACATTTTAATTTTACCTGGATTTGGAATAATTTCACATATTTTAAGTCAAGAAAGTGGTAAAAATGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATACTAGCAATTGGTCTTCTAGGTTTTGTTGTATGAGCTCATCATATATTTACAGTAGGAATAGATGTAGATACTCGTGCCTACTTTACCTCTGCTACAATAATTATTGCTGTTCCTACAGGAATCAAAATTTTTAGTTGATTAACTACTATATATGGTTCACGTATTTCATATAGTCCTGCATGTTTATGATCACTTGGATTCGTATTTTTATTTACTATTGGTGGTTTAACAGGAGTGGTTCTTGCTAATTCTTCAATTGATATTATTTTACATGACACTTATTATGTAGTAGCTCATTTTCATTATGTCTTATCAATAGGAGCCGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCTGGATTAACAATAAATCCAAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACCTTCTTCCCACAACACTTTTTAGGTTTATCAGGTATACCACGACGATATTCTGATTATCCAGATGCTTACACTTCATGAAATATTGCTTCATCACTAGGTAGAATCATTTCTTTAGTAAGAATTCTATTTTTTATTTATATTTTATGAGAAAGTATAGTATCAAATCGACAAGTTATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAATCACTTCCTCCAGCTGAACATAGATATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATCAATCAATAATTATTGTAAT-TTATAAAGAAGAGTTAA-ATTAATCTTCCA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATATCTAATTAAAATATTAAATTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAATCAAATTTCAGCCTTTTCACTAAAAAGTAAAATTCAAAACAATAAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAA--TAATTATCAGTGGGCAGGTTAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Calv581      CCAGAGGTTTACATTTTAATTCTACCTGGATTTGGAATAATTTCACATATTTTAAGTCAAGAAAGTGGTAAAAATGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATACTAGCAATTGGTTTACTAGGTTTTGTCGTATGAGCTCATCATATATTTACAGTAGGAATAGATGTAGATACCCGTGCTTACTTTACCTCTGCTACAATAATTATTGCTGTTCCTACAGGAATCAAAATTTTTAGTTGATTAACTACTATATACGGTTCACGTATTTCATATAGTCCTGCCTGTTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTTCTTGCTAATTCTTCAATTGATATTATTTTACATGATACTTATTATGTAGTAGCTCATTTTCATTACGTCTTATCAATAGGAGCCGTATTTGCAATTATAGCTGGATTTATTCAATGATACCCTTTATTTTCTGGTTTAACAATAAATCCAAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACCTTCTTCCCACAACACTTTTTAGGGTTATCAGGTATACCACGCCGATATTCTGATTATCCGGATGCTTACACTTCATGAAATATTGCTTCATCATTAGGTAGAATTATTTCCTTAGTAAGAATTCTATTTTTCATTTATATTTTATGAGAAAGTATAGTATCAAATCGACAAGTAATATTCACTTTAAATACAGAAAATTCAATTGAATGATTACAATCACTTCCTCCAGCTGAACATAGATATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAATGGATCAAATCAATCAATAATTATTGTAAT-TTATAAAGAAGAGTTAA-ATTAATCTTCTA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAACATCTAATTAAAATATTAAATTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAATCAAATTTCAGCCTTTTCACTAAAAAGTAAAATTCAAAATAATAAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAA--TAATTATCAGTGGGCAGGTTAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Bied629      CCAGAAGTTTATATTCTAATTTTACCTGGATTTGGAATAATTTCACACATTTTAAGACAAGAAAGTGGTAAAAATGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTCTTTTAGGATTTGTAGTATGAGCTCATCATATATTTACAGTAGGTATAGATGTAGACACTCGTGCTTATTTTACTTCTGCTACAATAATCATTGCTGTTCCTACAGGAATCAAAATTTTTAGTTGATTAACTACTATATATGGTTCTCGTATTTCATATAGTCCTGCATGTTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTCCTCGCTAATTCTTCAATTGATATTATTTTACATGATACTTACTATGTAGTAGCTCATTTTCACTACGTTTTATCAATAGGAGCAGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCTGGTTTAACAATAAATCCAAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACCTTCTTTCCACAACACTTTTTAGGATTATCAGGTATACCACGCCGTTACTCTGATTATCCTGATGCTTACACTTCATGAAATATTGCCTCATCACTAGGTAGAATTATTTCTTTAGTAAGAATTTTATTTTTCATTTATATTTTATGAGAAAGTATAATCTCAAATCGACAAGTAATATTTACTTTAAATACAGAAAACTCAATTGAATGATTACAATCACTTCCACCAGCTGAACATAGATATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCACCTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATTAATCAATAATTATTGTAAT-TTATGAAGAAGAGTTAA-ATTAATCTTCTA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATACCTAATTAAAATATTAAATTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATAAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATATTAAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAA--TAATTATCAGTGGGCAGGTTAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Bi.670       CCAGAAGTTTATATTCTAATTTTACCTGGATTTGGAATAATTTCACACATTTTAAGACAAGAAAGTGGTAAAAATGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTCTTTTAGGATTTGTAGTATGAGCTCATCATATATTTACAGTAGGTATAGATGTAGACACTCGTGCTTATTTTACTTCTGCTACAATAATCATTGCTGTTCCTACAGGAATCAAAATTTTTAGTTGATTAACTACTATATATGGTTCTCGTATTTCATACAGTCCTGCATGTTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTCCTCGCTAATTCTTCAATTGATATTATTTTACATGATACTTACTATGTAGTAGCTCATTTTCACTACGTTTTATCAATAGGAGCAGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCTGGTTTAACAATAAATCCAAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACCTTCTTTCCACAACACTTTTTAGGATTATCAGGTATACCACGCCGTTACTCTGATTATCCTGATGCTTACACTTCATGAAATATTGCCTCATCACTAGGTAGAATTATTTCTTTAGTAAGAATTTTATTTTTCATTTATATTTTATGAGAAAGTATAATCTCAAATCGACAAGTAATATTTACTTTAAATACAGAAAACTCAATTGAATGATTACAATCACTTCCACCAGCTGAACATAGATATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCACCTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATTAATCAATAATTATTGTAAT-TTATGAAGAAGAGTTAA-ATTAATCTTCTA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATACCTAATTAAAATATTAAATTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATAAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATATTAAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAA--TAATTATCAGTGGGCAGGTTAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Bi.671       CCAGAAGTTTATATTCTAATTTTACCTGGATTTGGAATAATTTCACACATTTTAAGACAAGAAAGTGGTAAAAATGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTCTTTTAGGATTTGTAGTATGAGCTCATCATATATTTACAGTAGGTATAGATGTAGACACTCGTGCTTATTTTACTTCTGCTACAATAATTATTGCTGTTCCTACAGGAATCAAAATTTTTAGTTGATTAACTACTATATATGGTTCTCGTATTTCATATAGTCCTGCATGTTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTCCTCGCTAATTCTTCAATTGATATTATTTTACATGATACTTACTATGTAGTAGCTCATTTTCACTACGTTTTATCAATAGGAGCAGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCTGGTTTAACAATAAATCCAAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACCTTCTTTCCACAACACTTTTTAGGATTATCAGGTATACCACGCCGTTACTCTGATTATCCTGATGCTTACACTTCATGAAATATTGCCTCATCACTAGGTAGAATTATTTCTTTAGTAAGAATTTTATTTTTCATTTATATTTTATGAGAAAGTATAATCTCAAATCGACAAGTAATATTTACTTTAAATACAGAAAACTCAATTGAATGATTACAATCACTTCCACCAGCTGAACATAGATATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCACCTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATTAATCAATAATTATTGTAAT-TTATGAAGAAGAGTTAA-ATTAATCTTCTA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATACCTAATTAAAATATTAAATTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATAAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATATTAAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAA--TAATTATCAGTGGGCAGGTTAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Wolf583      CCAGAAGTTTATATTTTAATTTTACCTGGATTTGGGATAATTTCCCATATTTTAAGTCAAGAAAGTGGTAAAAATGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTCTATTAGGATTTGTAGTATGGGCTCATCATATATTTACAGTAGGAATAGATGTAGACACTCGTGCTTATTTTACTTCCGCTACAATAATTATTGCTGTTCCTACAGGTATCAAAATTTTTAGTTGATTAACTACTATATATGGATCTCGTATTTCATATAGTCCTGCATGTTTATGATCACTTGGGTTTGTATTTTTATTCACTATTGGTGGTTTAACAGGAGTAGTTCTTGCTAACTCTTCAATTGATATTATTTTACATGATACTTACTATGTAGTAGCTCACTTCCATTATGTTTTATCAATAGGAGCCGTATTTGCAATTATAGCTGGATTTATTCAATGATACCCTTTATTTTCTGGTTTAACAATAAATCCAAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTTTTTCCACAACATTTTTTAGGATTATCAGGTATACCACGTCGTTATTCTGATTATCCAGATGCTTACACTTCATGAAACATTGCCTCATCATTAGGTAGAATTATTTCTTTAGTAAGAATTTTATTTTTCATTTACATTTTATGAGAAAGTATAATTTCAAATCGACAAGTAATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAATCACTTCCTCCAGCCGAACATAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTATTAAAGGATCATATTAATCAATAATTATTGTAAT-TTATAAAGAAGAGTTAA-ATTAATCTTCTA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATAACCAATTAAAATATTAAATTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATTAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATA-TTAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAGGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAA--TAATTATCAGTGGGCAGGTTAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Wolf585      CCAGAAGTTTATATTTTAATTTTACCTGGATTTGGGATAATTTCCCATATTTTAAGTCAAGAAAGTGGTAAAAATGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTCTATTAGGATTTGTAGTATGGGCTCATCATATATTTACAGTAGGAATAGATGTAGACACTCGTGCTTATTTTACTTCCGCTACAATAATTATTGCTGTTCCTACAGGTATCAAAATTTTTAGTTGATTAACTACTATATATGGATCTCGTATTTCATATAGTCCTGCATGTTTATGATCACTTGGGTTTGTATTTTTATTCACTATTGGTGGTTTAACAGGAGTAGTTCTTGCTAACTCTTCAATTGATATTATTTTACATGATACTTACTATGTAGTAGCTCACTTCCATTATGTTTTATCAATAGGAGCCGTATTTGCAATTATAGCTGGATTTATTCAATGATACCCTTTATTTTCTGGTTTAACAATAAATCCAAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTTTTTCCACAACATTTTTTAGGATTATCAGGTATACCACGTCGTTATTCTGATTATCCAGATGCTTACACTTCATGAAACATTGCCTCATCATTAGGTAGAATTATTTCTTTAGTAAGAATTTTATTTTTCATTTACATTTTATGAGAAAGTATAATTTCAAATCGACAAGTAATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAATCACTTCCTCCAGCCGAACATAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTATTAAAGGATCATATTAATCAATAATTATTGTAAT-TTATAAAGAAGAGTTAA-ATTAATCTTCTA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATAACCAATTAAAATATTAAATTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATTAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATA-TTAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAGGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAA--TAATTATCAGTGGGCAGGTTAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Drie580      CCAGAAGTTTATATTTTAATTTTACCTGGATTCGGAATAATTTCTCATATTTTAAGTCAAGAAAGTGGTAAAAACGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTAGTATGGGCTCATCATATATTTACAGTAGGGATAGATGTAGACACTCGTGCTTACTTCACTTCTGCTACAATAATTATTGCTGTTCCTACAGGAATCAAAATTTTTAGTTGATTAACTACTATATATGGTTCTCGTATTTCATATAGTCCTGCATGTTTATGATCCCTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTTCTTGCTAACTCTTCAATTGATATCATTTTACATGATACTTATTATGTGGTAGCTCATTTCCACTACGTTTTATCAATAGGAGCCGTATTTGCAATCATAGCTGGATTTATTCAATGATACCCTTTATTTTCTGGATTAACAATAAATCCTAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTCTTTCCACAACACTTTTTAGGATTATCAGGTATACCACGTCGTTATTCTGATTACCCAGATGCTTACACTTCATGAAATATTGCCTCATCATTAGGTAGAATTATTTCTTTAGTAAGAATCCTATTTTTTATTTACATTTTATGAGAAAGTATAATTTCAAACCGACAAGTAATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAATCACTTCCTCCAGCTGAACATAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCATATTAATCAATAATTATTGTAAT-TTATAAAGAAGAGTTAA-ATTAATCTTCTA-GTCACCCCAACTAAATA--AAATAAAACAATATAATAAATAATAACTAATTAAAATATTAAATTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATTAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAA-TA-TTAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAGGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAA--TAATTATCAGTGGGCAGGTTAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1284]

Drie582      CCAGAAGTTTATATTTTAATTTTACCTGGATTCGGAATAATTTCTCATATTTTAAGTCAAGAAAGTGGTAAAAACGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTAGTATGGGCTCATCATATATTTACAGTAGGGATAGATGTAGACACTCGTGCTTACTTTACTTCTGCTACAATAATTATTGCTGTTCCTACAGGAATCAAAATTTTTAGTTGATTAACTACTATATATGGTTCTCGTATTTCATATAGTCCTGCATGTTTATGATCCCTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTTCTTGCTAACTCTTCAATTGATATCATTTTACATGATACTTATTATGTGGTAGCTCATTTCCACTACGTTTTATCAATAGGAGCCGTATTTGCAATCATAGCTGGATTTATTCAATGATACCCTTTATTTTCTGGATTAACAATAAATCCTAAATGATTAAAAATACAATTTATAATCATATTTGTAGGAGTTAATTTAACTTTCTTTCCACAACACTTTTTAGGATTATCAGGTATACCACGTCGTTATTCTGATTACCCAGATGCTTACACTTCATGAAACATTGCCTCATCATTAGGTAGAATTATTTCTTTAGTAAGAATCCTATTTTTTATTTACATTTTATGAGAAAGTATAATTTCAAACCGACAAGTAATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAATCACTTCCTCCAGCTGAACATAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCATATTAATCAATAATTATTGTAAT-TTATAAAGAAGAGTTAA-ATTAATCTTCTA-GTCACCCCAACTAAATA--AAATAAAAAAATATAATAAATAATAACTAATTAAAATATTAAATTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATTAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAA-TA-TTAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAGGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAA--TAATTATCAGTGGGCAGGTTAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1284]

Dr.672       CCAGAAGTTTATATTTTAATTTTACCTGGATTCGGAATAATTTCTCATATTTTAAGTCAAGAAAGTGGTAAAAACGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTAGTATGGGCTCATCATATATTTACAGTAGGGATAGATGTAGACACTCGTGCTTACTTTACTTCTGCTACAATAATTATTGCTGTTCCTACAGGAATCAAAATTTTTAGTTGATTAACTACTATATATGGTTCTCGTATTTCATATAGTCCTGCATGTTTATGATCCCTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTTCTTGCTAACTCTTCAATTGATATCATTTTACATGATACTTATTATGTGGTAGCTCATTTCCACTACGTTTTATCAATAGGAGCCGTATTTGCAATCATAGCTGGATTTATTCAATGATACCCTTTATTTTCTGGATTAACAATAAATCCTAAATGATTAAAAATACAATTTATAATCATATTTGTAGGAGTTAATTTAACTTTCTTTCCACAACACTTTTTAGGATTATCAGGTATACCACGTCGTTATTCTGATTACCCAGATGCTTACACTTCATGAAACATTGCCTCATCATTAGGTAGAATTATTTCTTTAGTAAGAATCCTATTTTTTATTTACATTTTATGAGAAAGTATAATTTCAAACCGACAAGTAATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAATCACTTCCTCCAGCTGAACATAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCATATTAATCAATAATTATTGTAAT-TTATAAAGAAGAGTTAA-ATTAATCTTCTA-GTCACCCCAACTAAATA--AAATAAAAAAATATAATAAATAATAACTAATTAAAATATTAAATTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATTAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAA-TA-TTAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAGGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAA--TAATTATCAGTGGGCAGGTTAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1284]

Dr.673       CCAGAAGTTTATATTTTAATTTTACCTGGATTCGGAATAATTTCTCATATTTTAAGTCAAGAAAGTGGTAAAAACGAAGCTTTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTAGTATGGGCTCATCATATATTTACAGTAGGGATAGATGTAGACACTCGTGCTTACTTCACTTCTGCTACAATAATTATTGCTGTTCCTACAGGAATCAAAATTTTTAGTTGATTAACTACTATATATGGTTCTCGTATTTCATATAGTCCTGCATGTTTATGATCCCTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTTCTTGCTAACTCTTCAATTGATATCATTTTACATGATACTTATTATGTGGTAGCTCATTTCCACTACGTTTTATCAATAGGAGCCGTATTTGCAATCATAGCTGGATTTATTCAATGATACCCTTTATTTTCTGGATTAACAATAAATCCTAAATGATTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTCTTTCCACAACACTTTTTAGGATTATCAGGTATACCACGTCGTTATTCTGATTACCCAGATGCTTACACTTCATGAAATATTGCCTCATCATTAGGTAGAATTATTTCTTTAGTAAGAATCCTATTTTTTATTTACATTTTATGAGAAAGTATAATTTCAAACCGACAAGTAATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAATCACTTCCTCCAGCTGAACATAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCATATTAATCAATAATTATTGTAAT-TTATAAAGAAGAGTTAA-ATTAATCTTCTA-GTCACCCCAACTAAATA--AAATAAAACAATATAATAAATAATAACTAATTAAAATATTAAATTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATTAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAA-TA-TTAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGCTTCTAATTAGGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTTAA--TAATTATCAGTGGGCAGGTTAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1284]

Cate625      CCAGAAGTTTATATTCTAATTTTACCAGGCTTTGGAATAATTTCTCATATTCTTAGTCAAGAAAGTGGGAAAAGTGAAGCCTTTGGTAATCTTGGTATAATCTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTAGTATGAGCACATCATATATTTACTATTGGAATGGATGTAGATACTCGAGCTTATTTTACTTCAGCTACAATAATTATTGCTGTTCCTACAGGAATTAAAATTTTTAGTTGATTAACTACTATATATGGATCACGCATTTCATATAGCCCAGCCTGCTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACTGGAGTAGTTCTTGCTAATTCTTCAATTGATATTATTCTACATGATACTTATTATGTAGTAGCTCATTTTCATTATGTCCTATCAATAGGAGCAGTATTTGCAATTATAGCTGGATTTATTCAATGATACCCTTTATTTTCTGGTTTGACAATAAATCCTAAATGATTAAAGATACAATTTGTTATTATATTTGTAGGTGTTAATTTAACTTTTTTTCCTCAACATTTCTTAGGATTATCAGGAATACCACGACGATATTCAGATTATCCTGATGCATATACATCTTGAAATATTGCTTCATCCTTAGGTAGAATCATTTCTTTAGTTAGAATTATATTCTTTATTTATATTTTATGAGAAAGTATAATTTCTAATCGACAAGTAATATTTACACTTAATACAGAAAATTCAATTGAATGATTACAATCATTACCTCCAGCTGAGCATAGTTATGATGAACTTCCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTGTAATCATTAATAAAGGATCAA-ATAATCAATAATCATTGTAAT-TTATAAGGAAGAGTTAA-ACTAGTCTTCCA-GTCACCCCAACCAAATA--TAATAAAATAATATAATAAATAACAACTAATTAAAATATTATTATATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATAACATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAA-TAATAAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGTTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGCCAGACTTTAAATTATTTTCAATAAAGACATGTTTTTGTTAAACAGGCG   [1284]

Kogel634     CCAGAAGTTTATATTCTAATTTTACCAGGCTTTGGAATAATTTCTCATATTCTTAGTCAAGAAAGTGGAAAAAGTGAAGCCTTTGGTAATCTTGGTATAATCTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTAGTATGAGCACATCATATATTTACTATTGGAATGGATGTAGATACTCGAGCTTATTTTACTTCAGCTACAATAATTATTGCTGTTCCTACAGGAATTAAAATTTTTAGTTGACTAACTACTATATATGGGTCACGCATTTCATATAGCCCAGCCTGCTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACTGGAGTAGTTCTTGCTAATTCTTCAATTGATATTATTCTACATGATACTTATTACGTAGTAGCTCATTTTCATTATGTACTATCAATAGGAGCAGTATTTGCAATTATAGCTGGATTTATTCAATGATACCCTTTATTTTCTGGCTTGACAATAAATCCTAAATGATTAAAGATACAATTTGTTATTATATTTGTAGGTGTTAATTTAACTTTTTTCCCTCAACATTTCTTAGGATTATCAGGAATACCACGACGATATTCAGATTATCCTGATGCATATACATCTTGAAACATTGCTTCATCCTTAGGTAGAATCATTTCTTTAGTTAGAATTATATTCTTTATTTATATTTTATGAGAAAGTATAATTTCTAATCGACAAGTAATATTTACACTTAATACAGAAAATTCAATCGAATGATTACAATCATTACCTCCAGCTGAGCATAGTTATGATGAACTTCCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTGTAATCATTAATAAAGGATCAA-ATAATCAATAATCATTGTAAT-TTATAAGGAAGAGTTAA-ACTAGTCTTCCA-GTCACCCCAACCAAATA--TAATAAAATAATATAATAAATAACAACTAATTAAAATATTATTATATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATAACATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAA-TAATAAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGTTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1284]

Gans575      CCAGAAGTGTATATTCTAATTTTACCAGGGTTTGGAATAATTTCTCATATTCTTAGTCAAGAAAGTGGAAAAAGTGAAGCCTTTGGTAATCTTGGTATAATTTTTGCAATATTAGCAATTGGCTTATTAGGATTCGTAGTATGAGCACATCATATATTTACTATTGGAATGGATGTGGATACTCGAGCATATTTTACTTCAGCTACAATAATTATTGCTGTTCCTACAGGAATTAAAATTTTTAGTTGATTAACTACTATATATGGATCACGTATTTCATATAGTCCTGCCTGTTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACTGGAGTAGTCCTTGCTAATTCTTCAATTGATATTATCCTTCATGATACTTATTATGTAGTAGCTCATTTTCATTATGTCCTATCAATAGGAGCAGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCTGGTTTGACAATAAATCCTAAATGGTTAAAAATACAATTTGTTATTATATTTGTAGGTGTTAATTTAACTTTTTTTCCTCAACATTTCTTAGGATTATCAGGAATACCCCGACGATATTCAGATTATCCTGATGCATATACATCTTGAAATATTGCTTCATCTTTAGGTAGAATCATTTCTTTAGTTAGAATTATATTTTTTATTTATATTTTATGAGAAAGTATAATTTCTAATCGACAAGTAATATTTACACTTAATACAGAAAATTCAATTGAATGATTACAATCATTACCTCCAGCTGAACATAGTTATGATGAACTTCCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAA-ATATTCAATAATCATTGTAAT-TTATAAAGAAGAGTTAT-ATTAGTCTTCCA-GTCACCCCAACCAAATA--TAATAAAGTAATATAATAAATAACAACTAATTAAAATATTATTTTATTAGTATAAAGATCTATAGGGTCTTCTCGTCCTCCAATAACATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAA-TAATAAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGTTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGTCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1284]

Gans576      CCAGAAGTGTATATTCTAATTTTACCAGGGTTTGGAATAATTTCTCATATTCTTAGTCAAGAAAGTGGAAAAAATGAAGCCTTTGGTAATCTTGGTATAATTTTTGCAATATTAGCAATTGGCTTATTAGGATTCGTAGTATGAGCACATCATATATTTACTATTGGAATAGATGTGGATACTCGAGCATATTTTACTTCAGCTACAATAATTATTGCTGTTCCTACAGGAATTAAAATTTTTAGTTGATTAACTACTATATATGGATCACGTATTTCATATAGTCCTGCCTGTTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGTGGTTTAACTGGGGTAGTCCTTGCTAATTCTTCAATTGATATTATCCTTCATGATACTTATTATGTAGTAGCTCATTTTCATTATGTCCTATCAATAGGAGCAGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCTGGTTTGACAATAAATCCTAAATGGTTAAAAATACAATTTGTTATTATATTTGTAGGTGTTAATTTAACTTTTTTTCCTCAACATTTCTTAGGATTATCAGGAATACCCCGACGATATTCAGATTATCCTGATGCATATACATCTTGAAATATTGCTTCATCTTTAGGTAGAATCATTTCTTTAGTTAGAATTATATTTTTTATTTATATTTTATGAGAAAGTATAATTTCTAATCGACAAGTAATATTTACACTTAATACAGAAAATTCAATTGAATGATTACAATCATTACCTCCAGCTGAACATAGTTATGATGAACTTCCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAA-ATATTCAATAATCATTGTAAT-TTATAAGGAAGAGTTAT-ATTAGCCTTCCA-GTCACCCCAACCAAATA--TAATAAAGTAATATAATAAATAACAACTAATTAAAATATTATTTTATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATAACATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAA-TAATAAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGTTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGTCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1284]

Ga.669       CCAGAAGTATATATTCTAATTTTACCAGGGTTTGGAATAATTTCTCATATTCTTAGTCAAGAAAGTGGAAAAAGTGAAGCCTTTGGTAATCTTGGTATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTAGTATGAGCACATCATATATTTACTATTGGGATGGATGTGGATACTCGAGCATATTTTACTTCAGCTACAATAATTATTGCTGTTCCTACAGGGATTAAAATTTTTAGTTGATTAACTACTATATATGGATCACGCATTTCATATAGTCCTGCCTGTTTATGATCACTTGGATTTGTATTTTTATTTACTATTGGAGGTTTAACTGGAGTAGTCCTTGCTAATTCTTCAATTGATATTATCCTTCATGATACTTACTATGTAGTAGCTCATTTTCATTATGTCCTATCAATAGGAGCAGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCTGGTTTAACAATAAATCCTAAATGATTAAAAATACAATTTGTTATTATATTTGTAGGTGTTAATTTAACTTTTTTTCCTCAACATTTCTTAGGATTATCAGGAATACCCCGACGATACTCAGATTATCCTGATGCATATACATCTTGAAATATTGCTTCATCTTTAGGTAGAATCATTTCTTTAGTTAGAATTATATTCTTTATTTATATTTTATGAGAAAGTATAATTTCTAATCGACAAGTAATATTTACACTTAATACAGAAAATTCAATTGAATGATTACAATCATTACCTCCAGCTGAACATAGTTATGATGAACTTCCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAG-ATAATCAATAATCATTGTAAT-TTATAAGGAAGAGTTAT-ACTAGTCTTCCA-GTCACCCCAACCAAATA--TAATAAAGTAATATAATAAATAACAACTAATTAAAATATTATTTCATTAATATAAAGATCTATAGGGTCTTCTCGTCCTCCAATAACATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAA-TAATAAATATGAGACAGAAAATACCTTGTCCAACCATTCATACAAGTTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGTCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1284]

Twee584      CCTGAGGTGTATATTTTAATTTTACCTGGATTTGGAATAATCTCACATATTTTAAGTCAAGAGAGTGGTAAAAATGAAGCCTTTGGTAATCTTGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTCGTTGTATGGGCTCATCATATATTTACTGTAGGAATAGATGTTGATACTCGAGCTTACTTTACTTCAGCAACAATAATCATTGCTGTTCCAACAGGAATTAAAATTTTTAGATGATTAACTACAATATATGGATCACGAATATCATATAGCCCTGCCTGTTTATGATCACTCGGATTTGTATTCCTATTTACTATTGGAGGATTAACTGGAGTAGTTCTAGCTAATTCTTCAATTGATATTATTTTACATGACACCTATTATGTAGTAGCTCATTTCCATTATGTCTTATCAATAGGAGCAGTATTTGCAATTATAGCAGGATTTATTCAATGATACCCTTTATTCTCAGGTCTAACAATAAATCCTAAATGATTAAAAATACAATTCATAATTATATTTGTAGGAGTTAATCTAACATTTTTTCCACAGCACTTTTTGGGATTATCAGGAATACCACGTCGATATTCAGATTATCCTGATGCATATACTTCATGAAATATCGCTTCATCATTAGGTAGCATTATTTCCCTAGTTAGAATCTTATTTTTCATTTACATTTTATGAGAAAGTATAATTTCAAATCGACAAGTAGTATTTCCTATAAATACAGAAAATTCAATTGAATGACTACAATCACTACCTCCAGCTGAACATAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAA-ACAATCAATAATTATTGTAAT-TAATTAAGAAGAGTTAA-AGTAATCTTCCA-GTCACCCCAACCAAATA--AAATAAAATAATATAAAAAATACTAACTAATCAAAATATTATTAAATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAATAATATTTTAGCCTTTTCACTAAAAAATAAAATTCAAAATAATAAATATGAGACAGAAAGTATCTTGTCCAACCATTCATTCAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGTCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Ga.668       CCTGAGGTGTATATTTTAATTTTACCTGGATTTGGAATAATCTCACATATTTTAAGTCAAGAGAGTGGTAAAAATGAAGCCTTTGGTAATCTTGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGGGCTCATCACATATTTACTGTAGGAATAGATGTTGATACTCGAGCTTACTTTACTTCAGCAACAATAATCATTGCTGTTCCAACAGGAATTAAAATTTTTAGATGATTAACTACAATATATGGATCACGAATATCATATAGACCTGCCTGTTTATGATCACTCGGATTTGTATTCCTATTTACTATTGGAGGGTTAACTGGAGTAGTTCTAGCTAACTCTTCAATTGATATTATTTTACATGACACCTATTATGTAGTAGCTCATTTCCATTATGTCTTATCAATAGGGGCAGTATTTGCAATTATAGCAGGATTTATTCAATGATACCCTTTATTCTCAGGTCTAACAATAAATCCTAAATGATTAAAAATACAATTCATAATTATATTTGTAGGAGTTAATCTAACATTTTTCCCACAGCACTTTTTGGGATTATCAGGAATACCACGTCGATATTCAGATTATCCTGATGCATATACTTCATGAAATATCGCTTCATCATTAGGTAGCATTATTTCCCTAGTTAGAATCTTATTTTTCATTTACATTTTATGAGAAAGTATAATTTCAAATCGACAAGTAGTATTTCCTATAAATACAGAAAATTCAATTGAATGACTACAATCACTACCTCCAGCTGAACATAGCTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAA-ACAATCAATAATTATTGTAAT-TAATTAAGAAGAGTTAA-AGTAATCTTCCA-GTCACCCCAACCAAATA--AAATAAAATAATATAAAAAATACTAACTAATCAAAATATTATTAAATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAATAATATTTTAGCCTTTTCACTAAAAAATAAAATTCAAAATAATAAATATGAGACAGAAAGTATCTTGTCCAACCATTCATTCAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGTCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Raws587      CCTGAAGTATATATCTTAATTTTACCTGGATTTGGAATAATCTCACATATTTTAAGTCAAGAGAGTGGTAAAAATGAAGCCTTTGGTAATCTTGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCTCATCATATATTTACTGTAGGAATAGATGTTGATACTCGAGCTTACTTTACCTCAGCAACAATAATCATTGCTGTTCCAACAGGAATTAAAATTTTTAGATGATTAACTACAATATATGGATCACGAATCTCTTACAGACCAGCGTGTTTATGATCACTTGGATTTGTATTTCTATTTACTATTGGAGGATTAACTGGAGTAGTTCTAGCTAATTCTTCAATTGATATCATTTTACATGACACCTACTATGTAGTAGCTCATTTTCATTACGTCTTATCAATAGGAGCAGTATTTGCAATTATAGCAGGATTTATTCAATGATACCCTTTATTCTCAGGTCTAACAATAAATCCTAAATGATTAAAAATACAATTCATAATTATATTTGTAGGAGTTAATTTAACATTTTTTCCACAACACTTTTTAGGGTTATCAGGAATACCACGTCGATATTCAGATTACCCTGATGCATATACTTCATGAAATATCGCCTCATCACTAGGTAGAATTATTTCCCTAATTAGAATCTTATTTTTCATTTACATTTTATGAGAAAGTATAATTTCAAATCGACAAGTAGTATTTACTCTGAATACAGAAAATTCAATCGAATGACTACAATCACTACCTCCAGCTGAACACAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTGTAATCATTAATAAAGGATCAA-ATAATCAATAATTATTGTAAT-TAATTAAGAAGAGTTAA-AGTAATCTTCCA-GTCACCCCAACCAAATA--AAACAAAATAATATAAAAAATATTAACTAATCAAAATATTATCCAATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAATTATATTTTAGCCTTTTCACTAAAAAATAAAATTCAAAATAATAAATATGAGACAGAAAGTATCTTGTCCAACCATTCATTCAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGTCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Raws586      CCTGAAGTATATATCTTAATTTTACCTGGATTTGGAATAATCTCACATATTTTAAGTCAAGAGAGTGGTAAAAATGAAGCCTTTGGTAATCTTGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCTCATCATATATTTACTGTAGGAATAGATGTTGATACTCGAGCTTACTTTACCTCAGCAACAATAATCATTGCTGTTCCAACAGGAATTAAAATTTTTAGATGATTAACTACAATATATGGATCACGAATCTCTTACAGACCAGCGTGTTTATGATCACTTGGATTTGTATTTCTATTTACTATTGGAGGATTAACTGGAGTAGTTCTAGCTAATTCTTCAATTGATATCATTTTACATGACACCTACTATGTAGTAGCTCATTTTCATTACGTCTTATCAATAGGAGCAGTATTTGCAATTATAGCAGGATTTATTCAATGATACCCTTTATTCTCAGGTCTAACAATAAATCCTAAATGATTAAAAATACAATTCATAATTATATTTGTAGGAGTTAATTTAACATTTTTTCCACAACACTTTTTAGGGTTATCAGGAATACCACGTCGATATTCAGATTACCCTGATGCATATACTTCATGAAATATCGCTTCATCACTAGGTAGAATTATTTCCCTAATTAGAATCTTATTTTTCATTTACATTTTATGAGAAAGTATAATTTCAAATCGACAAGTAATATTTACTCTGAATACAGAAAATTCAATCGAATGACTACAATCACTACCTCCAGCTGAACACAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTGTAATCATTAATAAAGGATCAA-ATAATCAATAATTATTGTAAT-TAATTAAGAAGAGTTAA-AGTAATCTTCCA-GTCACCCCAACCAAATA--AAACAAAATAATATAAAAAATATTAACTAATCAAAATATTATCCAATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAATTATATTTTAGCCTTTTCACTAAAAAATAAAATTCAAAATAATAAATATGAGACAGAAAGTATCTTGTCCAACCATTCATTCAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGTCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Raws632      CCTGAAGTATATATCTTAATTTTACCTGGATTTGGAATAATCTCACATATTTTAAGTCAAGAGAGTGGTAAAAATGAAGCCTTTGGTAATCTTGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCTCATCATATATTTACTGTAGGAATAGATGTTGATACTCGAGCTTACTTTACCTCAGCAACAATAATCATTGCTGTTCCAACAGGAATTAAAATTTTTAGATGATTAACTACAATATATGGATCACGAATCTCTTACAGACCAGCGTGTTTATGATCACTTGGATTTGTATTTCTATTTACTATTGGAGGATTAACTGGAGTAGTTCTAGCTAATTCTTCAATTGATATCATTTTACATGACACCTACTATGTAGTAGCTCATTTTCATTACGTCTTATCAATAGGAGCAGTATTTGCAATTATAGCAGGATTTATTCAATGATACCCTTTATTCTCAGGTCTAACAATAAATCCTAAATGATTAAAAATACAATTCATAATTATATTTGTAGGAGTTAATTTAACATTTTTTCCACAACACTTTTTAGGGTTATCAGGAATACCACGTCGATATTCAGATTACCCTGATGCATATACTTCATGAAATATCGCCTCATCACTAGGTAGAATTATTTCCCTAATTAGAATCTTATTTTTCATTTACATTTTATGAGAAAGTATAATTTCAAATCGACAAGTAGTATTTACTCTGAATACAGAAAATTCAATCGAATGACTACAATCACTACCTCCAGCTGAACACAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTGTAATCATTAATAAAGGATCAA-ATAATCAATAATTATTGTAAT-TAATTAAGAAGAGTTAA-AGTAATCTTCCA-GTCACCCCAACCAAATA--AAACAAAATAATATAAAAAATATTAACTAATCAAAATATTATCCAATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAATTATATTTTAGCCTTTTCACTAAAAAATAAAATTCAAAATAATAAATATGAGACAGAAAGTATCTTGTCCAACCATTCATTCAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGTCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Ra.674       CCTGAAGTATATATCTTAATTTTACCTGGATTTGGAATAATCTCACATATTTTAAGTCAAGAGAGTGGTAAAAATGAAGCCTTTGGTAATCTTGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCTCATCATATATTTACTGTAGGAATAGATGTTGATACTCGAGCTTACTTTACCTCAGCAACAATAATCATTGCTGTTCCAACAGGAATTAAAATTTTTAGATGATTAACTACAATATATGGATCACGAATCTCTTACAGACCAGCGTGTTTATGATCACTTGGATTTGTATTTCTATTTACTATTGGAGGATTAACTGGAGTAGTTCTAGCTAATTCTTCAATTGATATCATTTTACATGACACCTACTATGTAGTAGCTCATTTTCATTACGTCTTATCAATAGGAGCAGTATTTGCAATTATAGCAGGATTTATTCAATGATACCCTTTATTCTCAGGTCTAACAATAAATCCTAAATGATTAAAAATACAATTCATAATTATATTTGTAGGAGTTAATTTAACATTTTTTCCACAACACTTTTTAGGGTTATCAGGAATACCACGTCGATATTCAGATTACCCTGATGCATATACTTCATGAAATATCGCTTCATCACTAGGTAGAATTATTTCCCTAATTAGAATCTTATTTTTCATTTACATTTTATGAGAAAGTATAATTTCAAATCGACAAGTAATATTTACTCTGAATACAGAAAATTCAATCGAATGACTACAATCACTACCTCCAGCTGAACACAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTGTAATCATTAATAAAGGATCAA-ATAATCAATAATTATTGTAAT-TAATTAAGAAGAGTTAA-AGTAATCTTCCA-GTCACCCCAACCAAATA--AAACAAAATAATATAAAAAATATTAACTAATCAAAATATTATCCAATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAATTATATTTTAGCCTTTTCACTAAAAAATAAAATTCAAAATAATAAATATGAGACAGAAAGTATCTTGTCCAACCATTCATTCAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGTCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Raws630      CCTGAAGTATATATCTTAATTTTACCTGGATTTGGAATAATCTCACATATTTTAAGTCAAGAGAGTGGTAAAAATGAAGCCTTTGGTAATCTTGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGATTTGTTGTATGAGCTCATCATATATTTACTGTAGGAATAGATGTTGATACTCGAGCTTACTTTACCTCAGCAACAATAATCATTGCTGTTCCAACAGGAATTAAAATTTTTAGATGATTAACTACAATATATGGATCACGAATCTCTTACAGACCAGCGTGTTTATGATCACTTGGATTTGTATTTCTATTTACTATTGGAGGATTAACTGGAGTAGTTCTAGCTAATTCTTCAATTGATATCATTTTACATGACACCTACTATGTAGTAGCTCATTTTCATTACGTCTTATCAATAGGAGCAGTATTTGCAATTATAGCAGGATTTATTCAATGATACCCTTTATTCTCAGGTCTAACAATAAATCCTAAATGATTAAAAATACAATTCATAATTATATTTGTAGGAGTTAATTTAACATTTTTTCCACAACACTTTTTAGGGTTATCAGGAATACCACGTCGATATTCAGATTACCCTGATGCATATACTTCATGAAATATCGCCTCATCACTAGGTAGAATTATTTCCCTAATTAGAATCTTATTTTTCATTTACATTTTATGAGAAAGTATAATTTCAAATCGACAAGTAGTATTTACTCTGAATACAGAAAATTCAATCGAATGACTACAATCACTACCTCCAGCTGAACACAGTTATGATGAATTACCATTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTGTAATCATTAATAAAGGATCAA-ATAATCAATAATTATTGTAAT-TAATTAAGAAGAGTTAA-AGTAATCTTCCA-GTCACCCCAACCAAATA--AAACAAAATAATATAAAAAATATTAACTAATCAAAATATTATCCAATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAATTATATTTTAGCCTTTTCACTAAAAAATAAAATTCAAAATAATAAATATGAGACAGAAAGTATCTTGTCCAACCATTCATTCAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAATTATCAGTGGGCAGGTCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1285]

Cardo624     CCAGAAGTATACATTTTAATTCTACCAGGATTTGGTATGATTTCTCATATTTTAAGTCAAGAAAGTGGTAAAAATGAAGCATTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGGTTTGTTGTATGAGCACATCATATATTTACTGTAGGTATAGATGTAGATACCCGAGCCTATTTTACTTCAGCTACAATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTAGTTGACTTACCACTATGTATGGTTCACGTATTTCATACAGTCCAGCTTGTTTATGATCTCTTGGTTTTGTTTTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTACTTGCCAATTCTTCAATTGATATTATTTTACATGACACCTATTATGTAGTAGCACATTTCCATTATGTTTTATCAATAGGAGCTGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCAGGACTAACAATAAACCCAAAATGGTTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTTTTTCCCCAACATTTTCTAGGATTATCAGGTATACCACGTCGATATTCTGATTACCCAGATGCTTATACTTCATGAAATATCGCTTCATCTCTAGGAAGAATTATCTCTTTAGTAAGAATTTTATTTTTCATTTACATTCTATGAGAAAGAATAATTTCAAACCGTCAAGTTATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAACTTTTACCTCCTGCCGAACATAGTTATGATGAACTTCCTTTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATTAATCAATAATTACTGTAAT-TTTTAAAGAAGAGTTAA-ATTAATCTTCCA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATAACTAATTAAAATATTAATATATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAACAAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATAATAAATATGAGACAGAAAATACCTTGTCCAACCGTTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAAATATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Cardo626     CCAGAAGTATACATTTTAATTTTACCAGGATTTGGTATGATTTCTCATATTTTAAGTCAAGAAAGTGGTAAAAATGAAGCATTTGGTAATTTAGGAATAATTTTTGCAATATTAGCAATTGGTTTATTAGGGTTTGTTGTATGAGCACATCATATATTTACTGTAGGTATAGATGTAGATACCCGAGCCTATTTTACTTCAGCTACAATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTAGTTGACTTACCACTATGTATGGTTCACGTATTTCATACAGTCCAGCTTGTTTATGATCTCTTGGTTTTGTTTTTTTATTTACTATTGGTGGTTTAACAGGAGTAGTACTTGCCAATTCTTCAATTGATATTATTTTACATGACACCTATTATGTAGTAGCACATTTTCATTATGTTTTATCAATAGGAGCTGTATTTGCAATTATAGCTGGATTTATTCAATGATATCCTTTATTTTCAGGACTAACAATAAACCCAAAATGGTTAAAAATACAATTTATAATTATATTTGTAGGAGTTAATTTAACTTTTTTTCCCCAACATTTTCTAGGATTATCAGGTATACCACGTCGATATTCTGATTACCCAGATGCTTATACTTCATGAAATATCGCTTCATCTCTAGGAAGAATTATCTCTTTAGTAAGAATTTTATTTTTCATTTACATTTTATGAGAAAGAATAATTTCAAACCGTCAAGTTATATTTACTTTAAATACAGAAAATTCAATTGAATGATTACAACTTTTACCTCCTGCCGAACATAGTTATGATGAACTTCCTTTATTTAATCCAACATCGAGGTCGCAATCCTTTTTGTAGATATCAACTCTTAAAAAAGATAACGCTGTTATCCCTAAGGTAACTTATTCTTATAATCATTAATAAAGGATCAAATTAATCAATAATTACTGTAAC-TTTTAAAGAAGAGTTAA-ATTAATCTTCCA-GTCACCCCAACTAAATA--AAATAAAATAATATAATAAATAATAACTAATTAAAATATTAATATATTAATATAAAGATCTATAGGGTCTTCTCGTCCTACAACAAAATTTTAGCCTTTTCACTAAAAAGTAAAATTCAAAATAATAAATATGAGACAGAAAATACCTTGTCCAACCGTTCATACAAGCTTCTAATTAAGAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTAAA--TAAATATCAGTGGGCAGGCCAGACTTTAAATTATTATCAATAAAGACATGTTTTTGTTAAACAGGCG   [1286]

Back to Mantophasmatodea home page

Web page development and text by Simon van Noort (Iziko South African Museum) and Mike Picker (University of Cape Town)

 

Web page development and text by Simon van Noort (Iziko South African Museum) and Mike Picker (University of Cape Town).


Contact us if you can contribute information or images to improve this page.

 Mantophasmatodea home   Biodiversity Explorer home   Iziko home   Search